procaryotes: all bacteria, blue-green algae
archaea: (a special group of bacteria, with major differences)
eucaryotes: animals, plants, fungi (yeasts, mushrooms), protozoa, green algae, red algae, brown algae. etc. "protists"
Differences:
a) Nucleus: Bare DNA, membrane-bound nucleus
b) DNA chromosomes, histone proteins
c) organelles: endoplasmic reticulum, mitochondria, etc.
d) smaller ribosomes in procaryotes
* Note: size is not necessarily a difference; nor multicellularity
(and where to classify Archaea? Where to classify viruses??)
II) The concept of symbiosis
("symbionts", "symbiotic relationships")
Where to classify lichens (algae & fungi symbionts)(other examples of symbiosis:
green algae living inside cells of corals, etc.)
III) Mitochondria and Chloroplasts both evolved from symbiotic procaryotes living in the cytoplasm of eucaryotes.
IV) All life on earth use nucleic acid genes that code for the sequences of amino acids of proteins.
DNA ("transcription") RNA ("translation") protein synthesis
the same 20 amino acids; (almost) the same genetic code
V) "Model organisms" (favored in today's research)
mouse; Xenopus; Zebra fish; Drosophila; Caenorhabditis,
Arabidopsis, Chlamydomonas; E. coli; yeast (2) T-phage
? What are good properties for a model organism?
To what extent were the current model organisms deliberately chosen?
Who did the choosing? Can you figure that out?
VI) Molecular genetic techniques have become almost industrialized; examples
...total sequencing of all genes in many different species
..."chips" with DNA arrays (fig page 38)
... computer programs that compare amino acid sequences
and estimate functions of each gene's protein
VII) Genome sizes turn out not to vary simply in proportion
to size or complexity. Humans genes code for only about 30,000 different proteins (instead of the 50,000 to 100,000 that many people expected), and despite having enough DNA to code for millions of proteins.
The smallest genomes are as small as 500 genes (proteins)
Flies have about 14,000 genes (different proteins)
Our DNA contains lots of "junk" of various kinds:
viruses, "transposons", "pseudogenes" (& yet to be discovered)
VIII) Most genes can be classified into one of a few hundred "families of genes", classified by the shapes and functions of the proteins that they code for. (computer programs find these)
Mostly, these evolved from common ancestry. (rather than convergence)
Similar genes are said to be "homologous"
IX) Genes can sometimes be transferred as DNA from one organism to another ("horizontally")
Bacteria do this a lot; it is rare in eucaryotes, but can be done deliberately in making "transgenic" animals and plants
X) Differences in amino acid sequences of homologous proteins
vary in proportion to how many million years it has been since
a given pair of organisms had their most recent common ancestor
2) Categorize each of the following as to whether they are procaryotes or eucaryotes: bacteria, blue green algae; green algae, mushrooms; oak trees; humans;
3) Name a model organism that is:
4) Can human genes be transferred to bacteria? Would you expect?
Can animal genes be transferred to plants? Would you expect?
5) Which of the following contain their own DNA genes?
7) About how many genes does a given species of bacteria have?
8) About how many different genes do humans have?
9) Could another species of animal have more genes than humans, even though it doesn't have any more DNA per cell?
10) Could another species have more genes, but less DNA per cell? (as compared with humans)
11) What is meant by genetically engineered plants or animals?
12) What is a transgenic animal or plant?
13) How does this differ from the traditional methods by which domesticated animals and plants were produced?
14) How does it differ from the mechanisms by which bacteria get 20% of their genes "horizontally" by uptake of DNA from other species of bacteria?
15) Would you think it could be possible to put genes into chloroplasts or mitochondria by some artificial methods?
16) If E colihas about 4000 base pairs of DNA,
and humans have 3 billion base pairs per set of chromosomes.
And E coli have about 4000 genes, then what would be about the maximum number of genes that humans could have, if we used our DNA efficiently?
17) Compare the number of "megs" of memory in your computer's hard drive to the number of megs that could be stored in a million base pairs of DNA.
18) What about megs per billion base pairs of DNA?
19) What is closer to a byte of computer memory? one base pair, or one codon? Does it matter than we use 4 different bases?
Could you have a genetic code with only two bases (like only A and T?)
In that case, how long would codons have to be to code for a total of 20 different amino acids? hint : 2,4,8,16,32
20) Could you have a genetic code with 6 bases (A-T, G-C, X-Y)?
hints: what are the relations between 4,16,64,? and 6,36,216, ?
so if there were 6 bases, then how many bases per codon?
21) Are there more humans on the earth than there are base pairs in our chromosomes? Is this a coincidence, do you think?
22) Compare the similarity in gene base sequences between two random people, as compared with people versus chimps.
23) What about humans versus mice? Humans versus fish?
24) The more important a gene, the more/less its amino acid sequence will tend to change in evolution??
25) What if a certain part of an enzyme protein were cut off before it begins to function! The speed of evolutionary change in amino acid sequence of this part of the protein should be slower/faster as compared with the rate of evolutionary change
in the rest of the protein?
26) What about the part of a gene that codes for that is the active site, where the enzyme binds to its substrate chemical?
(would you expect this to evolve slower or faster)
27) Suppose that gene A only serves one function, but gene B serves two different independent functions (otherwise no relation between the two functions)
then which gene will change fastest in evolution?
{HINT: most mutations are harmful, only a small percentage improve things; that is because they are random changes; and if you make random changes in, say, the engine of a car, most of these changes will be bad for it. A possible exception is the UNC administration, where random changes would have a good chance of being improvements (ignore that!). Anyway, it stands to reason that if a gene has several independent effects, then changing that gene will have several consequences, and if here is a small chance of any one change being beneficial, then there is even a smaller chance that one or the other effect wouldn't be bad. So if a gene has two or more independent effects, maybe it should evolve slower. If fact, some genes DO change much slower than other ones; so people try to figure out sensible reasons why that might occur.}
HINT: Have you ever heard of anatomical structures that are vestigial (or thought to be vestigial)
= that serve no function, anymore, but were used some ancestor from which we evolved. We somehow can't stop forming the structure because of some unknown kind of evolutionary "inertia".
Do you know of any structures that were thought to be vestigial, but really weren't?
28) Suppose that a given protein functions by binding tightly and specifically to other copies of this same protein! Then would you expect small differences in its amino acid sequence to affect this tight binding? Suppose that small differences DID weaken the binding;
how would you expect that to alter the rate of evolutionary change in this protein? If at all?
HINT: some proteins change much faster in evolution than others. (Two of the slowest are actin and histones)
29) Suppose an enzyme evolves to catalyse some completely different chemical reaction! "to boldly catalyse, where no enzyme had ever catalysed before"
Where would the new gene come from? probably?
30) Our bodies produce antibody proteins that bind specifically to germs, and this is how we become immune to diseases.
The shape of the binding sites of antibody molecules (i.e. which kind of germ they will bind to) result from the amino acid sequence.
Thus, antibodies against different germs have different amino acid sequences.
Does that mean they have to be coded for by different genes?
If humans have only 30,000 genes, then can we ever become immune to 40,000 different kinds of germs?
Would it help if the genes for the antibody molecules had very, very fast mutation rates! Fast enough to evolve during your own life-time?!
(that was one theory! It is only partly true!) The main mechanism does depend on evolution!!
b) Are there any kinds of bacteria that are eucaryotes?
c) Are there any kinds of bacteria that are NOT procaryotes?
d) Which are more closely related to humans: fungi or bacteria?
*e) Can you suggest a logical reason why fungal diseases are often much harder to cure in humans and other animals, in comparison to bacterial diseases?
f) What about diseases caused by protozoa? Such as amoebae?
*g) Which would be more useful for treating diseases:
#An antibiotic that selectively blocks certain biochemical processes that occur in eucaryotes but not procaryotes?
## An antibiotic that does the reverse, blocking parts of the metabolism that occur in procaryotes, but not eucaryotes?
### Drugs that poison both procaryotes and eucaryotes?
h) If the purpose of the drug were cancer chemotherapy, then which of these 3 sets of properties would you want it to have?
i) Several antibiotics used to treat bacterial diseases also damage mitochondria: why is this not surprising?
j) If such antibiotics also harmed plants, then what organelle might they harm, other than mitochondria?
k) Do plants even have mitochondria?
Don't plants have chloroplasts, instead?
l) For each of the following, which is true?
# both procaryotes and eucaryotes? (at least some of each)
## procaryotes but NOT eucaryotes?
### eucaryotes but NOT procaryotes?
n) Bacteria make ATP using energy from the diffusion of hydrogen ions through their membranes; So do mitochondria and chloroplasts. Can you suggest how this might be related to the evolution of chloroplasts and mitochondria?
o) If some particular kind of plant or animal somehow lost all of its mitochondria and chloroplasts, then would that loss make it a procaryote? Would any other loses make it so?
p) Would this species be capable of photosynthesis or of oxidative metabolism?
q) Why use symbiotic bacteria to do your photosynthesis?
Not to mention, to oxidize your food?
Does this mean that procaryotes can do certain biochemical processes that eucaryotes never evolved?
What do you suppose these might be?
r) If life had evolved more than once, maybe 2 or 3 separate times, then which different life forms came from each?
s) What if some group used a different genetic code?
t) What if some group used RNA as its genetic material (not DNA)
u) What if some group encoded amino acid sequences by some means other than purine & pyrimidine side-chains on chains of alternating phosphate-ribose-phosphate-ribose-phosphate-ribose?
v) What if some group made its enzymes out of RNA or DNA instead of out of proteins?
w) If humans someday find life on other planets, what experimental criteria should they use to deduce whether it evolved separately?
x) If life on other planets did evolve separately, rank the improbability of each of the following:
Animals and plants on these planets can be eaten by humans, in the sense of providing nutrients, but not being poisonous?
Their biochemistry is also based on enzymes and energy coupling?
II) Strengths of kinds of chemical bonds (measured in what?)
III) Entropy is a measure of what? Measured in what?
A 10-fold ratio of concentrationsis "worth" how much what?
IV Brownian movement is an example of what? How fast?
V) Why does a substrate fit its enzyme? What are other examples
VI) What are biological catalysts? How do they work?
VII) Are any enzymes not proteins? Are any parts of the protein ones not proteins?
VIII) How do enzymes work? What shape fits best into their active sites?
IX Heating has what effect on chemical reactions? Why?
X) What decides which chemical reactions will occur in the body?
XI) How to force energy-absorbing chemical reactions to occur?
XII) How to use phosphorylation to drive polymerization.
(some specific examples of energy coupling)
XIII) Are water molecules ever subdivided in syntheses?
XII) What is the Krebs cycle, & what is it an example of?
For (nearly) every combination of H, O, N & C that you can draw
(that obeys these valance rules) there really IS such a chemical.
The molecular weightof a chemical is the sum of the atomic weights of all of the atoms in its structure.
H2 gas has a molecular weight of 1+1= 2
O2 gas has a molecular weight of 16+16= 32
CH4 gas (methane) has a molecular weight of 12 + 4 = 16
CO2 gas has a molecular weight of 12 + 16 + 16 = 44
N2 gas has a molecular weight of 18+18= 36
CH3CH2OH (alcohol) 12 + 3 + 12 + 2 +16 + 1 = 46
2 grams of hydrogen has the same number of molecules as 46 grams of alcohol, etc. (that's the key point)
This much of a substance is called one mole of alcohol
(the specific number is called Avogadro's number, and because it was discovered long after the invention of the concept of molecular weights, so it isn't a round number. It is 6.023 x 1023
(But notice that it is surprisingly close to a round number, actually)
II) Strengthsof different kinds of chemical bonds
(which turn out to be measured in energy)
Covalent bonds 100 kcal/mole actually ~25-226
Ionic bonds 3 kcal/mole (again, a range of variation)
Hydrogen bonds (H between O & N) 1 kcal/mole (in water)
van der Waals bonds ("London-van der Waals") 1/10th kcal/mole
Hydrophobic bonding (caused by lack of ionic & H bonds)
(Atoms "want" to form strongest possible combinations of bonds)
A-B + C-D --> A-C + B-D
What determines the preferred direction of this reaction??
if the strength of the A-B bond is 10 units, and the strength of the A-C bond is 20 units etc. ... invent your own bond strengths)
(most explosives depend on forming very strong N N triple bonds)
III) Entropy is a specific useful (defined) measure of disorder =randomness
This tendency of randomness to increase can exert large forces
examples include: osmotic pressure ;membrane voltages
in a chemical reaction X(somewhat random) <-> Y(more random)<BR> which direction will this reaction tend to go, spontaneously?
going back to the other reaction A-B + C-D <-> A-C + B-D
suppose that in addition to the change in bond energies
there were also a difference in entropy
how would the entropy change affect the direction of the reaction?
The concept of thermodynamic free energy was invented to predict
such counterbalancing effects between energy and entropy
Free energy change = energy release minus entropy increase (times temperature)
(you don't need to learn the equation, but here is... G = H - TS
A specially important example is that a 10-fold ratio of concentrations is "worth" 1.4 kilocalories per mole, & a 100-fold ratio is worth 2.8 kilocalories per mole, etc.
A 14 kilocalorie per gram molecular weight is equivalent to 14 kilocalories
Therefore, can you predict the equilibrium ratios of AB, CD, AC & BD chemicals, based on the different bond strengths?
If the energy released by bonding between a Q and an R atom were used to pump molecules of Z from one side of a membrane to the other side, then what would be the maximum ratio of concentrations that could be produced, based on the bond energy?
IV) Diffusion is sufficient to move small molecules from end of a cell to another, and back, many times per second. heat is thermal motion. Brownian Movement everything vibrates 2/3 kT bigger things move slower, smaller things move faster
V) Complementary shapes (& charge distributions, H-bonding etc.)
will spontaneously bind to each other (automatically!) and thermal
vibrations are sufficient to bring them into alignment.
Note that enzymes do NOT change the equilibrium ratios of products and reactants!!
The equilibrium ratio depends on the free energy difference!
(if the free energy difference were 7 kilocalories per mole then why would the equilibrium ratio be 105
=100,000 times the concentration of products as reactants)?
IMPORTANT THOUGHT QUESTION:
Suppose that an enzyme speeds up a reaction by 1000 times, can you calculate the amount by which this enzyme must be lowering the free energy barrier? (hint 1.4 x 3 zeros) What if an enzyme speeded up a reaction one million times. (e.g. a million molecules/sec. instead of one molecule per sec.?)
? Are there ANY ways to change the free energies of chemicals, given that enzymes can't do this?
Wouldn't enzymes be better if they could change free energies? If they can't, what can?
VII) Some enzymes have been found to be made of RNA, instead of being proteins?
"Ribozymes" This discovery won the Nobel Prize a few years ago (Cech & Altman)
This supports the hypothesis that the first life forms to evolve may have been made of RNA (proteins and DNA both evolving later)
Many enzymes have special non-protein molecules at their active sites: These are called coenzymes
Several are vitamins (for example, vitamin C, most of the B vitamins)
Some are energy carriers: example CoEnzymeA
Many enzymes have metal ions at their active sites:
Iron, Zinc, Cobalt, Molybdenum & others
VIII)How do enzymes work? By stabilizing the intermediate stages of their particular chemical reaction!
(because the shape and charge distribution of the enzyme binding site is complementary to the shape that the reactant chemicals have when they are half-way through the reaction)
In other words, the shape of the active site fits best around the shape that the reacting chemicals will have during the stage of the reaction that would otherwise have the highest free energy.
IX)Temperature effects: small increases in temperature will cause relatively large increases in rates of chemical reactions. (unless the heating damages the enzymes)
Look at the graph on the bottom of page 76 in the textbook
Percentages of molecules having different amounts of heat energy
X) Enzymes decide which reactions will occur, instead of others (by lowering the activation energies of some, but NOT lowering the activation energies for alternate reactions)
XI) The (very important) concept of energy coupling!
How to borrow some of the energy from energy-releasing reactions
and then use this energy to drive other reactions backward "up hill"
(like a hydroelectric dam uses downhill water flow to generate electricity, that can then do work.)
Another analogy is earning money at one job, and then using the money to hire somebody else to do something you want done.
"carrier molecules" (analogous to money; or to xerox cards)BR>
ATP adenosine triphosphate --> AMP & Phosphate & Phosphate
NAD & NADH (nicotinamide adenine dinucleotide)
(in which the high energy form carries one extra hydrogen)
(used for energy, sometimes by forcing a hydrogen
to bond covalently to some chemical = "reduction")
NADP & NADPH (almost the same, but with an extra phosphate)
(but are used for different sets of reactions)P>
FAD & FADH2D "flavine adenine dinucleotide"
(the high energy form binds two hydrogens & can reduce things)
Coenzyme A & its high energy form acetyl coenzyme A
(high energy form has an acetic acid attached; & can force this acetic acid to bind covalently to certain other molecules)
XII: Phosphorylation,
And its use to drive polymerization reactions
ATP + Z --> ADP + Z-P
Z-Z-Z-Z-Z + Z-P --> Z-Z-Z-Z-Z-Z
"Tail polymerization": polysaccharides, RNA, DNA
Y-Y-Y-Y-Y-P + Y-P--> Y-Y-Y-Y-Y-Y-P
"Head polymerization": proteins, fatty acids
XIII) Hydrolysis
lots of chemical reactions that release an OH and an H
XIV) Linked chains of chemical reactions
and especially the Krebs Cycle
b) If you know the molecular structure of a chemical, how do you calculate the molecular weight of that chemical? (& what else do you need to know? That you can look up in a book?)
c) How do you calculate the weight of 6x1023 molecules of that chemical? (in grams)
d) The strengths of chemical bonds turn out to be measured in units of what per what?
(furlongs per fortnight? Distance per time? Cubic distance /weight, force /broken bond
or what????) e) Which kind of chemical bonds are strongest? Which are weakest? Which are pseudo-bonds?
f) In chemical reactions, do atoms tend to form weaker and weaker bonds, or what?
g) Is there any relation between heat released and the strength of new bonds formed? Or lost?
h) Entropy is a measure of what? in general terms?
**i) Entropy is measured in what per what per what?
**j) By what criterion did C. P. Snow say that you can distinguish a scientifically educated person?
(Hint: equivalent to being familiar with Shakespeare) {Answer: Snow said that understanding the second law of thermodynamics, about entropy tending to increase, was the equivalent.}
k) A ten-fold ratio of concentrations (ten times more molecules/volume on one side)
is worth how much energy per mole.
l) If a chemical reaction produces a net increase of total bond energies of 14 kcal/mole, then at equilibrium the ratio of reactants to products will be ten to the power of what?
m) If the energy released by bonding between a Q and an R atom were used to pump molecules of Z from one side of a membrane to the other side, then what would be the maximum ratio of concentrations that could be produced, based on the bond energy?
n) Compare the Brownian movement of a light object with a heavier one?
o) If an average bacterium is diffusing around in water, about how many minutes will it take to move a distance equal to its own diameter?
p) What about the time needed for molecules to move from one end of a cell to the other end?
*q) Could you measure the approximate weight of objects by tracking their Brownian movements?
*r) If two objects of equal weight were falling through space, and suddenly became connected, would they speed up or slow down?
*s) What about two objects undergoing Brownian movement (instead of falling by gravity)?
u) How would you expect viscosity to affect Brownian movements?
v) What are 5 or 6 cases in which biologically-important molecules become attached specifically
by means of complementary shapes & bonds?
w) How can enzymes decide which chemical reactions occur and which do NOT occur?
or do they?
x) If an enzyme lowers the activation energy of a reaction by 1.4 kilocalories/mole, then how much will this enzyme speed up the reaction?
y) By how much energy per what would an enzyme need to lower an activation energy in order to speed up a reaction by a million fold?
z) The binding site of an enzyme should be complementary in shape and charge distribution to what? # The reactant chemicals? # The product chemicals? # What else?
1) If (by some mistake) the binding site of an enzyme were complementary in shape to one of the wrong answers in the preceding question, then what effect would this mistaken "enzyme" have?
2) Antibodies are proteins that bind exactly to molecules that have certain specific shapes: could an antibody enzymatically catalyse a reaction?
3) The antibodies binding site would need to be exactly complementary to what shape?
(in order for it to act as an enzyme?)
Then what would you need to use as precursors if the polymer that you wanted to synthesize consisted of alternating sugars and phosphates?
Sugar-Phosphate-Sugar-Phosphate-Sugar-Phosphate-Sugar-etc..
S-P-S-P-S-P-S-P-S-P-S-P-S-P-S-P-S-P-S-P-S-P-S-P-S-P-S-P-S-
{answer: your precursor molecule would need to be S-P-P or maybe even S-P-P-P
the point is that it will need to give up at least one of the phosphates to provide the energy,
and after giving up that phosphate, you are joining together alternating sugars and phosphates,
therefore you have to start out with sugars having at least 2 phosphates, each}
What if, instead you wanted to make a polymer in which each sugar alternates with two phosphates in a row?
Sugar-Phosphate-Phosphate-Sugar-Phosphate-Phosphate
S-P-P-S-P-P-S-P-P-S-P-P-S-P-P-S-P-P-S-P-P-S-P-P-S-P-P-S-etc.
{HINT: you need to start with at least 3 phosphates: S-P-P-P
in order to give up one for energy, and still have 2 left.
Next, imagine that you wanted to make a polymer that had side chains off of each sugar?!! (like, maybe, benzene rings, or anything) (& each sugar alternating with a phosphate Sketch the chemical structures of what kind of high-energy precursor molecule you would need.
Imagine polymerizing a chain of molecules in which the high energy monomer had the following structure:
Adenosine-Sugar-Phosphate-Phosphate-Phosphate
What would the polymer look like??
Suppose that the sugar were ribose?
Suppose that the monomers also included GTP, CTP & UTP ?
Do you see what I am hinting at? !
{this set of Socratic questions was intended to lead you toward grasping that ATP, that
weird molecule that our cells use to carry energy, is itself one of the 4 precursors
for the polymerization of RNA! In other words, in the same sense that phospho-glucose is the activated precursor for making strings of glucoses, like cellulose, if you want to make a chain consisting of alternating sugars and phosphates, with funny side-chains on the sugars, in other words if you want to make RNA, then your precursor needs to be a sugar with a side chain and also with 2 or 3 phosphates. Do you get the point now? It is so simple that most people never get it!}
What if our genetic material used a different sugar, like a 6 - carbon sugar,
or suppose that adenine wasn't one of the 4 nucleic bases,
Then do you suppose that we would use ATP as our primary chemical for transferring energy from one reaction to another? {hint: no}
What would we use instead? {hint, if our genetic material used xanthine as a side chain instead of using adenine, and if our genetic material used glucose instead of ribose, then instead of using ATP as our genetic material, we would use Xanthine-Glucose-Phos-Phos-Phos}
{I just used Xanthine because it starts with an X}
Look at the chemical structures of NAD, NADH, FAD and even coenzyme-A.
Find the adenine! Find the ribose(s)! Locate the phosphates!
Are we in a rut, chemical-structure-wise or what?
Curiosity questions:
Did you learn about ATP and NAD in previous courses?
Did anybody mention how similar their chemical structures are?
What about their relations to RNA synthesis?
Does our textbook even make this point all clearly?
It is believed that the first living things on earth may have been made entirely of RNA (no protein).
Suppose instead they had been made entirely of proteins
(no nucleic acids), in that case what would we probably use instead of ATP as our energy transfer chemical?
When ATP hydrolyses to ADP and Phosphate, the broken chemical bonds between the phosphates are replaced by newly formed bonds between nearby water and these phosphates.
Suppose that somebody added up the total strengths of all the bonds that had existed before the hydrolysis, and then also added up the total strengths of all the bonds that existed afterward,
which total would be larger?
By about how many kilocalories per Avogadro's number?
Is it really, literally true what everybody says about the ATP bonds having particularly high energy?
What bonds have even higher energy?
Suppose by some magic, that you could make these phosphate-to-phosphate bonds have twice as much energy, and leave all the other bond issues the same as they are in the real world, then what effect would this have on the usefulness of ATP?
Are people kind of silly, or what? Is sloppy thinking a form of entropy?
Why not change the definition of the gram to make it equal to the weight of 2 times 1024 molecules of hydrogen gas? or maybe 12 times 1024 atoms of carbon?
Do you see why, if scientists were going to invent a new measure of weight (comparable to Napoleon's weighing system, or Caesar's month lengths and leap years, etc.) then we might use the weight of some round number of atoms.
Questions Regarding Cinderella's glass slipper:
a) Compare the binding affinity of Cinderella's slipper to the feet of her sisters, as compared with its binding affinity to her feet?
b) If the characters in this story were molecules (very small), then how could the prince have used radioactive atoms and duplicate copies of the shoe in order to locate Cinderella, without having to send people out to look for her?
c) Suppose that feet like Cinderella's feet somehow had lower free energy than feet shaped like her sisters, and suppose that they had an aunt whose feet happened to be midway in shape between the shape of Cinderella's feet and the shapes of her sisters' feet,
how might you make enzymes that could convert back and forth between feet of the two extreme shapes?
d) What would be the equilibrium ratio of concentrations of Cinderella versus concentrations of her sisters? (assume some particular difference in free energy of their feet-shapes)
e) Would Cinderella's shoes have fallen off, if they fit so exactly?
f) If they fit really well, could she have gotten them off, even after she got home?
g) What if she wiggled her toes around? Why would that have helped get her shoes off?
h) Do you suspect that perhaps Cinderella "ejected" one of her shoes, as a deliberate method for being tracked down later?
i) Should the step-sisters perhaps have done surgery on their feet?
(In the original Grimm Brothers' version, guess what they do?)
Suppose you tried to carve enzymes out of some kind of plastic
(if you had an infinitely sharp knife, and were very smart)
What shape, and what charge distribution on the surface of this shape, would you choose
II) For each protein, there is a certain geometric pattern of folding which the amino acid chain will spontaneously do. (sometimes with a little help from heat shock proteins)
The unfolded state is said to be "denatured". Refolding of an unfolded chain is "renaturation".
If you denature an antibody, and then renature it, it will form the same shaped binding site as before.
If you denature an enzyme, and then renature it, it will form the same shaped active site as before.
III) The folding of amino acid chains (= proteins) is caused by the specific sequence of amino acids in the chain. The rules governing folding are the following (most important 1st)
A) So as to put the uncharged (= hydrophobic) groups inside
B) So as to put the charged groups on the outside (with water)
C) So as to put C=Os and the C-N-Hs next to each other
to allow hydrogen bonding -C=O to H-N-C-
and there are 2 main ways this is done: ("secondary structure")
alpha helix & "pleated sheet" = beta sheet
D) proline prevents folding into the alpha helix pattern,
and thereby causes kinks= ends of alpha helix
because it can't participate in the alpha helix pattern
E) cysteine can form disulfide bonds to other cysteines (covalent bonds!)
"primary structure" = a.a. sequence,
"secondary structure" = locations of alpha helices & beta sheets
"tertiary structure" = arrangements of helices and sheets etc.
"quaternary structure" = combination of multiple proteins
The meaning of "Domains"
IV) There are computer programsthat can predict protein conformations
based on amino acid sequences. But they get it wrong ~10% of the time!
(notice that the textbook implies otherwise)
V) But computers can recognize similarities in sequences resulting from having evolved from the same genes and/or serving the same functional purpose. "Families of genes"
So you can often predict function from primary structure.
A limited number of "modules" are observed
VI) Rates of catalysis
fastest enzymes catalyse as many as a million reactions/sec
at the other (slow) extreme, DNA replication goes at hundreds
of nucleotide pairs per second (in eucaryotes) & faster in bacteria!
VII) Allosteric effects:
What happens when enzymes have several different binding sites
Binding at one site will often cause slight refolding in a protein, which can change the shapes of other binding sites!
If enzyme "A" has separate binding sites for X and Y,
& if being bound to X changes the enzyme's conformation in such a way that it now binds better to Y, then you can predict the reverse will also be true.
VIII) Graphing how reaction rates vary as a function of concentration of reactant (substrate) molecules. "Michaelis-Menton kinetics" and all that...("KAY-EM")
"Km" is an inverse measure of binding & specificity
It is the concentration of reactant at which the rate of binding
(& rate of catalysis) is one-half the maximum it would be at a very, very large concentration. (& there is a tricky way to calculate it) (high Km means weak binding / low Km means strong binding)
IX) Proteins can bind to other proteins for many purposes:
1) self assembly of virus capsids
2) formation of fibers (actin, microtubules; collagen)
3) to form complex enzyme machines (protein synthesis)
4) to allow sigmoid enzyme kinetics (like hemoglobin)
X) Monomers; versus the advantage of dimers, trimers, tetramers
Binding of reactant to one of 4 tetramers (when the others are not bound) will weaken the binding of the tetramers to each other.
& Conversely, when the other 3 tetramers already are bound to reactants, then the binding of the 4th is favored.
Figure # 3-59 shows this in the reverse case, when chemicals are INHIBITING an enzyme. I think that the authors just don't realize that the same principle also applies to hemoglobin etc.
(this is why so many enzymes are trimers & tetramers, etc.
in order to make their rate-concentration curve S-shaped)
XI) There are two important ways to cause proteins to undergo non-permanent changes in conformation (fold slightly differently)
#1) Covalently bond a phosphate onto it.
Specific enzymes that do this are called kinases.
Other specific enzymes ("phosphatases") cut them off again.
Only 3 of the 20 amino acids can have phosphates bonded to them
These are the 3 that have -OH groups on their side chains
They are serine, threonine, and tyrosine.
Many cancers are caused by over-active kinases
#2) Put a GTP into a binding site on a GTPase protein
Such a protein (GTPase) will then remain in its altered conformation until they cleave the GTP to GDP.
NOTE: don't assume that this is for energy coupling!!
Such GTPases are very, very, very slow enzymes.
Often the reaction half-life is 1 cleavage per second, or less
The purpose is to amplify some signal.
As many as 1/5 of human cancers may be caused by one specific kind of GTPase that gets stuck in its GTP-bound state
(and never manages to catalyse the GTP->GDP hydrolysis)
b) Can you figure out why heat denatures proteins?
*c) What properties would allow chemicals to denature proteins?
(hint: what is most important factor controlling conformation:
hydrophobic groups where?)
d) If the binding site of an enzyme were square and this enzyme was then denatured by heating, and then allowed to renature by gradual cooling, then what shape would its binding site have after renaturation?
*e) If you wanted a chemical fixative , that would kill cells but "lock" them permanently into their normal shapes, then how might you do this?
**f) What would be the effect of such a fixative on a protein's susceptibility to denaturation, by chemicals or other treatments?
g) If two different proteins happened to have the same number of glycines, the same number of alanines, and the same number of every other amino acid, then would they fold into the same shape?
h) If you somehow switched the sequence of several amino acids in a certain protein, could that change the folded shape of the protein?
i) Suggest some specific substitutions of amino acids that would be predicted to have the largest effects on conformation.
j) Which should produce a bigger difference, substituting a negatively-charged side chain for a positively-charged side chain, or substituting a charged side chain for a hydrophobic one?
k) Why would removing a cysteine NOT cause denaturation,
but possibly could lower the amount of temperature need to cause denaturation.
l) If you want to denature proteins completely, why do you need to add chemicals that react with SH groups?
(which is how permanent waves and hair straighteners work)
*m) If an abnormal combination of cysteines form disulfide bonds with each other, then how can that lock a protein into an abnormal conformation = tertiary and/or quaternary structure.
(= prevent normal renaturation) (permanent waves etc.)
n) If you cut out various different parts of proteins, or synthesized just some of the amino acid sequences of a given protein, why would they not fold properly unless these sequences corresponded to domains?
o) Every place in a protein's amino acid sequence where there is a proline, what happens to the alpha helix at that point (IF there IS one)? * Can you guess why having a glycine next to the proline makes this change even more certain?
p) Having two or three prolines in a row probably means what?
(hint: this is related to domains).
q) If brief treatment with a weak protein-digesting enzyme consistently cuts a certain protein at the same 3 locations along its amino acid chain, then how many domains does this protein probably have, normally? And what is your reasoning?
r) An important experiment done near here showed that antibodies re-form the same shaped binding sites when denatured and then renatured. What does this imply?
Conversely, what would the results have implied (about the relations between binding site shapes and amino acid sequence)
if antibodies would switch from one specificity to another.
***s)What is the paradox of the following facts?
*t) Imagine that a certain protein could switch part of its secondary structure, so that a certain sequence of amino acids could switch from being an alpha helix to become part of a beta sheet: could that possibly cause a disease?
*u) Suppose that this switching from one secondary structure to another could be stimulated in one copy of a given protein by it being next to another copy of this protein that had already undergone the change? Then could the disease be catching?
v) Would such a disease behave as if it were caused by a virus, but would not be carried either by DNA or RNA genes?
In what respect would it seem to be virus-caused?
By what sorts of techniques could you prove that is isn't?
w)A rather fast enzyme can catalyse about how many reactions per second? What about a slow enzyme?
x) Suppose that a certain enzyme has different binding sites for two different chemicals: can you make any predictions about how the presence of one chemical will affect the binding of the other chemical to the enzyme (although the binding sites are different)
y) What does it mean if one enzyme has a higher Km than another?
z) What advantage is achieved by enzymes being tetramers?
1) How do viruses form their protein coats?
2) How do protein monomers form long fibers?
3) Are there any methods by which cells make temporary changes in their own enzymes and other proteins?
4) How could one of these methods be prevented by mutations that specifically removed either serines, threonines or tyrosines?
5) How can cancer be caused by certain enzymes becoming too slow, in the rates at which they catalyse their reactions?
6) What other kind of enzymecan cause cancer by over-activity
{in procaryotes, DNA is simply in the cytoplasm: NO nucleus
II)(Another eucaryote/procaryote difference) During mitosis, the DNA "condenses"/"compacts"
= folds up into tight masses called "Chromosomes" Humans have X and Y sex chromosomes
and 22 pairs of "autosomes" Total chromosome number 46
Each species of animal & plant has its own chromosome number
(for Drosophila, the chromosome number happens to be 4)
Chromosome homologs pair during meiosis (the parts with equivalent genes line up side-by side) (the mechanisms that cause this are not yet understood)
III) (Still another eucaryote/procaryote difference!!!)
While condensed like this, in mitosis & also meiosis
chromosomes can be "stained" with certain chemical dyes
and can also be labeled with single-stranded DNA made so that it has the complementary base sequence to certain genes.
Each human chromosome can be identified individually!
Deletions of particular genes can often be seen by missing bands!
"Translocations" of chromosomes at particular bands are the cause of several particular kinds of cancer. (& most lymphomas)
(For example: "The Philadelphia chromosome" --> lymphoma
IV) (ANOTHER of these special eucaryotic things! will they never end?)
Eucaryote DNA is wrapped around clusters of a certain kind of protein, called histones. (procaryotes don't have them!)
Interphase DNA looks like a string of beads (electron microscopy)
Each bead = "nucleosome" ~ 146 base pairs of DNA
Incidentally, the amino acid sequences of histones are almost exactly the same in plants as in animals, etc. very conservative!!
V) (guess what? Yep! This one is another "eucaryotes only" item)
Eucaryote chromosomes have special end structures "telomeres"
(2 telomeres per each chromosome)
Telomeres keep the ends of the DNA from "unraveling" (sort of)
Telomerase enzyme rebuilds the last ~200 bases each time the DNA is copied in between cell divisions)
(Maybe the cause of aging is failure of telomerase enzyme??)
!{procaryote DNA is in circular rings; so there are no ends}!
VI) Centromeres and kinetochores(again eucaryotes only)
A particular part of each chromosome gets pulled on by special fibers during mitosis and meiosis
#1) first pulls chromosome pairs to "equator" of cell
#2) then pull separated chromosomes to "poles" of cell
The centromere = length of DNA where this attachment occurs<BR>
The kinetochore= collection of proteins that aggregate there
and which are the mechanical connection to microtubules
In case you are interested to know it
(Kerry Bloom in this dept has long been a world expert on the particular DNA base sequences that are the centromeres in yeast)
(Ted Salmon in this dept is a world expert on kinetochores)
{{{{and say goodby to procaryotes again, because the next 2 items are peculiar just to just a few special eucaryotes!}}}}
VII) Lampbrush chromosomes (in frog oocytes / egg cells) DNA is somewhat condensed, but with loops out to sides. Loops turned out to be double stranded DNA
(visible by light microscope!)
VIII) Polytene chromosomes (in fly glands, etc.)
DNA duplicated to as many as 1000 + copies;
All DNA strands continue to lie parallel to the others;
therefore chromosomes and bands are easily visible in light microscope; bands can be correlated with particular genes etc.
Chromosome "puffs" form where particular genes are transcribing lots and lots of RNA
IX) In all eucaryotes, certain parts of the chromosomes stain more darkly, tend to be genetically inactive, and have very high concentrations of repeated base sequences
"Heterochromatin" versus "Euchromatin" (the rest)
Sometimes genes that get translocated from eu to heterochromatin
switch on and off irregularly ("position effect variegation")
In mammal female X chromosomes, the mechanism that turns off the genes in one or other X chromosome makes it heterochromatin
X) Particular chromosomes are now believed to sit mostly in particular relative locations in the nucleus during interphase!?
XI) Eucaryote genes (nearly all! not histones! who knows why?) have introns (intercalated lengths of base sequences, that get copied into RNA, but then spliced out of m-RNA.
This was a big surprise, and nobody really understands it yet!
There are lots of interesting hypotheses about why we have introns and also why we have so many duplicated sequences
People assume there must be SOME evolutionary advantage!
Many of the hypotheses are related to possible defense mechanisms against viruses.
A few particular species of eucaryotes (puffer fish "Fugu") happen to have very compact genomes (few introns), 400 million base pairs in comparison to 3.2 billion in humans
&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&
b) How many layers to the nuclear envelope?
c) What happens to the nuclear envelope during mitosis? (cell division)
d) The proteins in what layer or structure get what kind of ion bound to them covalently at this time? And for what purpose?
e) What is the normal ("diploid") human chromosome number? Do all kinds of animals and plants have the same number of chromosomes? What does it mean to say that the "haploid" chromosome number of Drosophila flies is 4? (The Haploid number in humans is 23)
f) How does the appearance of chromosomes change during mitosis? (as compared with being spread out and invisible during the rest of the cell cycle)
g) How are scientists able to see regular patterns of banding on mitotic chromosomes?
Can they also see genetic abnormalities, like broken chromosomes? And breaks that have rejoined to the wrong other chromosome? ("translocations")
*h) What was that business about "The Philadelphia Chromosome", certain forms of cancer, and a newly developed anti-cancer drug that acts by blocking certain ATPases?
i) What are histones, and what structures do they form in eucaryotic chromosomes?
j) How many telomeres per chromosome? Located where? What would happen if one were missing? What medical effects are thought likely to be caused by inadequate telomeres?
k) What is the relation between kinetochore and centromeres? Where are they?
l) What is special about the structure and appearance of chromosomes in frog egg cells?
m) What is special about the structure and appearance of chromosomes in salivary glands and some other tissues in the larvae flies and many other insects
n) What are chromosome "puffs"? Can they occur in just any kind of chromosome?
o) What do you call the parts of chromosomes that stain darkly, and where the genes tend to become inactive, and the proteins that they code for tend not to be made? That starts with an h.
p) What is noteworthy about the genome of puffer fish?
The reason really isn't known why histones change so slowly!
Another protein that changes very little is actin.
Has their structure already been "perfected"? Or do changed versions of these proteins not interact with normal ones??
Or does their function change less (compared with hemoglobin)?
Incidentally, somatic mutations are also important!
~90+% of human cancers are caused by somatic mutations
~30% of human deaths in US are caused by cancer
II) Normal mutation rates are VERY low!! 10-9 /generation
Both in procaryotes and eucaryotes ~ one per billion base pairs
(a "point" mutation being a replacement of a base by another.)
Historically, Delbruck and Schroedinger deduced that genes couldn't be protein conformations! Signals must be "digital"
Large energy barriers to changes: "aperiodic crystals"
Very deep energy wells; to be escaped so rarely.
III) But copying accuracy makes 1 mistake/100,000 b.p.!
99% of these mistakesare fixed by one proofreading mechanism
99% of the remaining mistakes fixed by another proofreading mechanism
? How did researchers find these proofreading mechanisms
and how did they distinguish between two of them?
Studied mutant bacteria, yeast, etc. that have mutations that prevent the proofreading ---> much higher mutation rates!
One such mutation in humans causes hereditary nonpolyposis coln cancer.
IV) DNA replication fork + "replication bubble"
New bases added only at the 3' end of the chain
NOTE: in both DNA and RNA, the ribose sugars have
one phosphates attached to their #3 carbon,
and have another phosphate attached to their #5 carbon.
DNA polymerizes only in the 5'->3' direction
(meaning that new bases are added at the end that has the phosphate on the #3 carbon of the ribose)
Therefore..."leading strand" in contrast to "lagging strand"
Okazaki fragments (copies along lagging strand)
also RNA primers...
V) DNA topoisomerases (of several kinds)
Topoisomerase I cut one strand of DNA, allow free rotation
Topoisomerase II allow one strand to pass through another
(new antibiotics: cyprofloxacin = baytril)
What kinds of experimental evidence originally revealed these?)
{Steve Matson, Prof this dept, is a world expert on topoisomerases}
VI) Replication origins
= specific base sequences scattered along chromosomes, 100+
base pairs that somehow stimulate where DNA polymerase will bind and begin replication.
In procaryotes: only one per chromosome
In eucaryotes, many per chromosome (best studied in yeast) mutants
VII) Telomerase enzymes, constantly replace chromosome ends
GGGTTA repeated over and over and over
GGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTA etc.This is a eucaryote thing; procaryotes have circular DNA
CCCAATCCCAATCCCAATCCCAATCCCAATCCCAATCCCAATCCCAATCCCAAT eag.
VIII) DNA repair
why is it needed? 5,000 depurinations per day/per cell in humans!
deaminations of adenine, guanine, and cytosine
pyrimidine dimers UV light
Two main kinds of enzymatic repair:
nucleotide excision repair "bulky lesions"
IX) Meiotic recombination : line up equivalent base sequences on 2 copies of homologous chromosomes
The molecular basis of genetic "crossing over" DNA hybridization
Cut one strand of each DNA, and pair bases, each to other strand.
"branch migration" "Holliday junction" (Robin Holliday)
Prof Patricia Pukkila of this dept is a world expert on recombination
& worked in Robin Holliday's lab in England before coming here.
General recombination can cause "gene conversion"
X) Many viruses can insert their DNA into host chromosomes
First discovered in Lamda bacteriophage (kappa particles in Paramecia)
Even some RNA viruses do this: example is HIV the AIDS virus
retroviruses
Transposons are virus-like DNA sequences that copy themselves (often many times) in human & other eucaryote genomes
>10% of human genome consists of transposon sequences
for example, a million copies of the alu sequence
Prof Lily Searles of this dept is a world expert on transposons
&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&
Review Questions related to chapter #5
a) Why is evolutionary change so much faster in the part of the fibrin gene that codes for the "fibrinopeptide"?
b) How does the rate of evolutionary change in histone genes compare with the rates of change in other genes?
c) What is meant by a somatic mutation? How do somatic mutations differ from the kinds of mutations that geneticists study (mostly)?
d) What category of human diseases are caused by somatic mutations in about 9 out of 10 cases?
e) The normal rate of mutations in humans is about how many base pair changes per cell division per 3 billion base pairs.
f) Historically, even before DNA was known to be the genetic material, what were some physicists able to figure out about the amounts of energy needed to produce individual mutations?
g) How much of the accuracy of DNA replication results from the polymerase enzymes themselves; and how much is contributed by additional mechanisms? The enzymes that find, remove and replace (new) bases that are paired with the wrong bases in the original DNA strand are said to be ------------?
(12 letter word; also used in ordinary life)
h) About what fraction of the mis-paired bases do these enzymes find and replace?
h) What is the phenotypic effect of mutations in the genes that code for these enzymes (that find and replace..etc.)
i) What is a "replication fork"? Where are replication forks located, relative to replication bubbles?
j) How many replication bubbles would you expect to find on the chromosome of a bacterium? What about the number of replication forks on a human chromosome (during the "S phase" of the cell division cycle, when DNA is being copied).
k) What are "Okazaki fragments"? In a replication bubble, where would Okazaki fragments be formed?
l) The end of a single strand of DNA or RNA which ends with a phosphate attached to the fifth carbon of a ribose is called the ? end.
m) What is the difference between the leading strand and the lagging strand of newly-synthesized DNA strands at a replication fork?
m) How many major kinds of topoisomerase enzymes are there? And what function is accomplished by each one of them?
n) What would be the phenotypes of mutations in the genes for topoisomerases?
o) What molecular process is catalysed by telomerase enzymes?
p) What is meant by tissue culture cells? In what sense do tissue culture cells undergo "aging"? NOTE: that this aging does NOT refer to how many years that the tissue culture cells have been in culture: so what does it refer to instead?
q) What evidence seems to prove that defective telomerase is NOT the cause of aging (hint: at least not in rodents)?
r) Depurinations, formation of pyrimidine dimers, and deaminations of DNA bases are examples of common spontaneous chemical reactions that usually do NOT result in mutations in normal people: why not?
s) Our mutation rate would be about how many times higher than it actually is if these chemical changes (in the previous question) were not repaired?
t) Can certain enzymes recognize the presence of xanthine and other abnormal purines in DNA (where adenine and guanine should be)? What do these enzymes then do? For what purpose? What would be the effect of eliminating the genes for such an enzyme?
u) What do geneticists mean by "recombination"?
v) How is the lining-up of homologous pairs of chromosomes in meiosis related to base pairing between single strands of DNA from each member of the chromosome pairs?
w) What is a Holliday junction? Do these junctions form mostly on hollidays, like Memorial day, or what?
x) What are retroviruses? (Their defining property?) What is an important specific example of a retrovirus?
y) What is a transposon? Are there any in humans?
z) What differences in molecular srructure are there between the amino acids cysteine and serine?